UB Paderborn / Katalog / Suche / in CDI

Sortiert nach

Einfacher Volltextzugriff von (fast) überall

Installieren Sie die LibKey Nomad-Browsererweiterung und erhalten Sie von vielen Webseiten einfachen Zugriff auf lizenzierte Volltexte oder Open Access Publikationen. Mehr erfahren...

Graphene oxide with the addition of different values of Ag nanoparticles

Journal of physics. Conference series, 2019-06, Vol.1221 (1), p.12013

2019

Volltextzugriff (PDF)

Photoconductivity studies on amorphous and crystalline TiO2 films doped with gold nanoparticles

Applied physics. A, Materials science & processing, 2011-06, Vol.103 (3), p.659-663

2011

Volltextzugriff (PDF)

Yttrium deposition on mesoporous TiO2: textural design and UV decolourization of organic dyes

Bulletin of materials science, 2015-02, Vol.38 (1), p.29-40

2015

Volltextzugriff (PDF)

Efectos de estilos de crianza sobre la depresión en adolescentes escolarizados de una muestra peruana

Revista de investigación en psicología, 2022-12, Vol.25 (2), p.39-54

2022

Volltextzugriff (PDF)

Theoretical study of electronic properties and chemical stability of cubic phase zirconia nanowires

Physica scripta, 2021-12, Vol.96 (12), p.125879

2021

Volltextzugriff (PDF)

In Situ FBG Monitoring of a Henequen-Epoxy Biocomposite: From Manufacturing to Performance

Chemistry an international journal, 2022-06, Vol.4 (2), p.380-392

2022

Volltextzugriff (PDF)

Effect of Au nanoparticles on the activity of TiO2 for ethanol upgrading reactions

Applied catalysis. A, General, 2018-02, Vol.551, p.23-33

2018

Volltextzugriff (PDF)

Effect of nanoparticles on the mechanical properties of kenaf fiber-reinforced bio-based epoxy resin

Textile research journal, 2021-06, Vol.91 (11-12), p.1313-1325

2021

Volltextzugriff (PDF)

Influence of the local dielectric constant on modeling the optical absorption of silver nanoparticles in silica gels

Colloids and surfaces. A, Physicochemical and engineering aspects, 2006-04, Vol.278 (1), p.1-9

2006

Volltextzugriff (PDF)

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

International journal of laboratory hematology, 2017-10, Vol.39 (5), p.539-545

2017

Volltextzugriff (PDF)

Influence of Oxygen on the Optical Properties of Silver Nanoparticles

Journal of nanoscience and nanotechnology, 2008-12, Vol.8 (12), p.6545-6550

2008

Volltextzugriff (PDF)

Yttrium deposition on mesoporous TiO sub(2): textural design and UV decolourization of organic dyes

Bulletin of materials science, 2015-02, Vol.38 (1), p.29-40

2015

Volltextzugriff (PDF)

Quenching effect in luminescent and magnetic properties of Fe3O4/α-Fe2O3/Y2O3:Eu3+ nanocomposites

Ceramics international, 2023-12, Vol.49 (24), p.41133-41141

2023

Volltextzugriff (PDF)

Modeling of optical absorption of silver prolate nanoparticles embedded in sol–gel glasses

Materials chemistry and physics, 2005-05, Vol.91 (1), p.88-93

2005

Volltextzugriff (PDF)

Thermochromic Properties of Silver Colloids Embedded in SiO2 Gels

Journal of sol-gel science and technology, 1998-01, Vol.13 (1-3), p.663-666

1998

Volltextzugriff (PDF)

New method to evaluate optical properties of core–shell nanostructures

Journal of nanoparticle research : an interdisciplinary forum for nanoscale science and technology, 2012-06, Vol.14 (6), Article 915

2012

Volltextzugriff (PDF)

Evaluation of the mechanical properties of biolaminates prepared by different manufacturing techniques

Revista de Materiales Compuestos, 2022

2022

Volltextzugriff (PDF)

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20ￂ bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of [beta]-Thalassemia in Mexican mestizo patients

International journal of laboratory hematology, 2017-10, Vol.39 (5), p.539

2017

Volltextzugriff (PDF)

Silver Nanoparticles Dispersed on Silica Glass for Applications as Photothermal Selective Material

Energy procedia, 2014, Vol.57, p.2241-2248

2014

Volltextzugriff (PDF)

Push-pull chromophores aggregation in SiO sub(2) sol-gel films doped with silver nanoparticles

Revista mexicana de física, 2011-04, Vol.57 (2), p.44-50

2011

Volltextzugriff (PDF)

Absorbancia y reflectancia de hojas de Ficus contaminadas con nanopartículas de plata

Revista mexicana de física, 2019-02, Vol.65 (1), p.95-105

2019

Volltextzugriff (PDF)

Photoconductivity studies on amorphous and crystalline Ti02 films doped with gold nanoparticles: Advances in Metamaterials and Photonics

Applied physics. A, Materials science & processing, 2011, Vol.103 (3), p.659-663

2011

Volltextzugriff (PDF)

Absorbancia y reflectancia de hojas de Ficus contaminadas con nanopartículas de plata

Revista mexicana de física, 2018-12, Vol.65 (1 Jan-Feb), p.95-105

2018

Volltextzugriff (PDF)

Effect of the Erbium Concentration in the Luminescent Properties of ZrO2

Computación y Sistemas, 2019-01, Vol.23 (1), p.21-25

2019

Volltextzugriff (PDF)

Photoconductivity studies of gold nanoparticles supported on amorphous and crystalline TiO sub(2) matrix prepared by sol-gel method

Revista mexicana de física, 2011-04, Vol.57 (2), p.13-18

2011

Volltextzugriff (PDF)

1 – 25 von 206

Suche als RSS-Feed

Suchergebnisse filtern

Filter anzeigen

Nur zeigen

Geprüft (Peer-Review)
(178)
Mit Volltextzugriff
(179)

Publikationsform

Sprache

1 weiteren anzeigen...

Weniger anzeigen...

Erscheinungsjahr

n.n

Thema

Science & Technology
(113)
Life Sciences & Biomedicine
(59)
Technology
(43)
Humans
(38)
Physical Sciences
(28)
Materials Science
(25)
Female
(24)
Male
(19)
Engineering
(18)
Chemistry
(15)
Animals
(14)
Materials Science, Multidisciplinary
(14)
Adult
(13)
Adolescent
(12)
Nanoparticles
(12)
Physics
(12)
Child
(11)
Environmental Sciences & Ecology
(11)
Genetics
(10)
Middle Aged
(10)

15 weitere anzeigen...

Weniger anzeigen...

Neu hinzugefügt

... seit 90 Tagen
(5)

Menü

Weitere Dienste

Einstellungen

Graphene oxide with the addition of different values of Ag nanoparticles

Photoconductivity studies on amorphous and crystalline TiO2 films doped with gold nanoparticles

Yttrium deposition on mesoporous TiO2: textural design and UV decolourization of organic dyes

Efectos de estilos de crianza sobre la depresión en adolescentes escolarizados de una muestra peruana

Theoretical study of electronic properties and chemical stability of cubic phase zirconia nanowires

In Situ FBG Monitoring of a Henequen-Epoxy Biocomposite: From Manufacturing to Performance

Effect of Au nanoparticles on the activity of TiO2 for ethanol upgrading reactions

Effect of nanoparticles on the mechanical properties of kenaf fiber-reinforced bio-based epoxy resin

Influence of the local dielectric constant on modeling the optical absorption of silver nanoparticles in silica gels

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

Influence of Oxygen on the Optical Properties of Silver Nanoparticles

Yttrium deposition on mesoporous TiO sub(2): textural design and UV decolourization of organic dyes

Quenching effect in luminescent and magnetic properties of Fe3O4/α-Fe2O3/Y2O3:Eu3+ nanocomposites

Modeling of optical absorption of silver prolate nanoparticles embedded in sol–gel glasses

Thermochromic Properties of Silver Colloids Embedded in SiO2 Gels

New method to evaluate optical properties of core–shell nanostructures

Evaluation of the mechanical properties of biolaminates prepared by different manufacturing techniques

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20ￂ bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of [beta]-Thalassemia in Mexican mestizo patients

Silver Nanoparticles Dispersed on Silica Glass for Applications as Photothermal Selective Material

Push-pull chromophores aggregation in SiO sub(2) sol-gel films doped with silver nanoparticles

Absorbancia y reflectancia de hojas de Ficus contaminadas con nanopartículas de plata

Photoconductivity studies on amorphous and crystalline Ti02 films doped with gold nanoparticles: Advances in Metamaterials and Photonics

Absorbancia y reflectancia de hojas de Ficus contaminadas con nanopartículas de plata

Effect of the Erbium Concentration in the Luminescent Properties of ZrO2

Photoconductivity studies of gold nanoparticles supported on amorphous and crystalline TiO sub(2) matrix prepared by sol-gel method

Suchergebnisse filtern