UB Paderborn / Katalog / Suche / in CDI

1 – 25 von 127

Sortiert nach

Indicaciones y valoración clínica del urocultivo y coprocultivo

Medicine - programa de formación médica continuada acreditado, 2010-02, Vol.10 (49), p.3317-3320

2010

Link zum Volltext

Verfügbarkeit prüfen

Indicaciones y valoración clínica del exudado faríngeo y del cultivo de esputo, exudado uretral, vaginal y de cérvix

Medicine - programa de formación médica continuada acreditado, 2010-02, Vol.10 (49), p.3321-3324

2010

Link zum Volltext

Verfügbarkeit prüfen

Spontaneous peritonitis in a cirrhotic patient with a cat: Pasteurella multocida infection of the ascitic fluid

Revista española de enfermedades digestivas, 1997-10, Vol.89 (10), p.786

1997

Link zum Volltext

Verfügbarkeit prüfen

A model predictive control strategy for supply chain optimization

Computers & chemical engineering, 2003-09, Vol.27 (8), p.1201-1218

2003

Link zum Volltext

Verfügbarkeit prüfen

Spatial heterogeneity in the Mediterranean Biodiversity Hotspot affects barcoding accuracy of its freshwater fishes

Molecular ecology resources, 2014-11, Vol.14 (6), p.1210-1221

2014

Link zum Volltext

Verfügbarkeit prüfen

Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women

Genetics and molecular research, 2013-07, Vol.12 (3), p.2755-2763

2013

Link zum Volltext

Verfügbarkeit prüfen

The CB1 receptor interacts with cereblon and drives cereblon deficiency-associated memory shortfalls

EMBO molecular medicine, 2024-04, Vol.16 (4), p.755-783

2024

Link zum Volltext

Verfügbarkeit prüfen

Fetal hemoglobin regulating genetic variants identified in homozygous (HbSS) and heterozygous (HbSA) subjects from South Mexico

Journal of tropical pediatrics (1980), 2022-08, Vol.68 (5)

2022

Link zum Volltext

Verfügbarkeit prüfen

Allergies and COVID‐19 vaccines: An ENDA/EAACI Position paper

Allergy (Copenhagen), 2022-08, Vol.77 (8), p.2292-2312

2022

Link zum Volltext

Verfügbarkeit prüfen

Optimizing CIGB-300 intralesional delivery in locally advanced cervical cancer

British journal of cancer, 2015-05, Vol.112 (10), p.1636-1643

2015

Link zum Volltext

Verfügbarkeit prüfen

Dynamic Modeling and Decentralized Control of Supply Chains

Industrial & engineering chemistry research, 2001-07, Vol.40 (15), p.3369-3383

2001

Link zum Volltext

Verfügbarkeit prüfen

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

International journal of laboratory hematology, 2017-10, Vol.39 (5), p.539-545

2017

Link zum Volltext

Verfügbarkeit prüfen

Pediatric Type 1 Diabetes: Is Age at Onset a Determining Factor in Advanced Hybrid Closed-Loop Insulin Therapy?

Journal of clinical medicine, 2023-11, Vol.12 (21), p.6951

2023

Link zum Volltext

Verfügbarkeit prüfen

Three-dimensional regional bi-ventricular shape remodeling is associated with exercise capacity in endurance athletes

European journal of applied physiology, 2020-06, Vol.120 (6), p.1227-1235

2020

Link zum Volltext

Verfügbarkeit prüfen

Circuit Breakers in Low- and Medium-Voltage DC Microgrids for Protection against Short-Circuit Electrical Faults: Evolution and Future Challenges

Applied sciences, 2022-01, Vol.12 (1), p.15

2022

Link zum Volltext

Verfügbarkeit prüfen

The ALHAMBRA survey: tight dependence of the optical mass-to-light ratio on galaxy colour up to z = 1.5

Astronomy and astrophysics (Berlin), 2019-01, Vol.622, p.A51

2019

Link zum Volltext

Verfügbarkeit prüfen

An innovative DNA extraction method: Water versus commercial buffers

Forensic science international. Genetics supplement series, 2019-12, Vol.7 (1), p.282-284

2019

Link zum Volltext

Verfügbarkeit prüfen

The ALHAMBRA survey: 2D analysis of the stellar populations in massive early-type galaxies at z < 0.3

Astronomy and astrophysics (Berlin), 2018-01, Vol.609, p.A20

2018

Link zum Volltext

Verfügbarkeit prüfen

Evaluation of two FTA card elutions with sterile vs distilled water

Forensic science international. Genetics supplement series, 2019-12, Vol.7 (1), p.727-729

2019

Link zum Volltext

Verfügbarkeit prüfen

Effect of β-glucans on viscoelastic properties of barley kernels and their relationship to structure and soluble dietary fibre

Journal of cereal science, 2012-11, Vol.56 (3), p.595-602

2012

Link zum Volltext

Verfügbarkeit prüfen

OP04.01: Unique cardiac remodelling in young adults born small for gestational age with subsequent central obesity

Ultrasound in obstetrics & gynecology, 2022-09, Vol.60 (S1), p.57-57

2022

Link zum Volltext

Verfügbarkeit prüfen

Antitumor effect of a novel proapoptotic peptide that impairs the phosphorylation by the protein Kinase 2 (casein Kinase 2)

Cancer research (Chicago, Ill.), 2004-10, Vol.64 (19), p.7127-7129

2004

Link zum Volltext

Verfügbarkeit prüfen

Inusual complicación en cirugía laparoscópica de urgencia: sección accidental de catéter de derivación ventriculoperitoneal

Cirugia Española, 2020-02, Vol.98 (2), p.97-97

2020

Link zum Volltext

Verfügbarkeit prüfen

Preliminary data about the influence of vitamin D status on the loss of body fat in young overweight/obese women following two types of hypocaloric diet

British journal of nutrition, 2008-08, Vol.100 (2), p.269-272

2008

Link zum Volltext

Verfügbarkeit prüfen

1 – 25 von 127

Suche als RSS-Feed

Suchergebnisse filtern

Filter anzeigen

Nur zeigen

Geprüft (Peer-Review)
(119)
Mit Volltextzugriff
(120)

Publikationsform

Artikel
(125)
Tagungsberichte
(2)

Sprache

Erscheinungsjahr

n.n

Thema

Science & Technology
(65)
Life Sciences & Biomedicine
(44)
Humans
(38)
Female
(25)
Male
(23)
Biological And Medical Sciences
(15)
Adult
(14)
Middle Aged
(14)
Physical Sciences
(14)
Physics
(13)
Aged
(12)
Astrophysics
(11)
Galaxies: Evolution
(11)
Red Shift
(11)
Spain
(11)
Astronomy & Astrophysics
(10)
Fundamental And Applied Biological Sciences. Psychology
(9)
Animals
(8)
Medical Sciences
(8)
Nutrition & Dietetics
(8)

15 weitere anzeigen...

Weniger anzeigen...

Neu hinzugefügt

... seit 30 Tagen
(1)
... seit 90 Tagen
(2)

Menü

Weitere Dienste

Einstellungen

Indicaciones y valoración clínica del urocultivo y coprocultivo

Indicaciones y valoración clínica del exudado faríngeo y del cultivo de esputo, exudado uretral, vaginal y de cérvix

Spontaneous peritonitis in a cirrhotic patient with a cat: Pasteurella multocida infection of the ascitic fluid

A model predictive control strategy for supply chain optimization

Spatial heterogeneity in the Mediterranean Biodiversity Hotspot affects barcoding accuracy of its freshwater fishes

Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women

The CB1 receptor interacts with cereblon and drives cereblon deficiency-associated memory shortfalls

Familial component of early-onset colorectal cancer: opportunity for prevention

Fetal hemoglobin regulating genetic variants identified in homozygous (HbSS) and heterozygous (HbSA) subjects from South Mexico

Allergies and COVID‐19 vaccines: An ENDA/EAACI Position paper

Optimizing CIGB-300 intralesional delivery in locally advanced cervical cancer

Dynamic Modeling and Decentralized Control of Supply Chains

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

Pediatric Type 1 Diabetes: Is Age at Onset a Determining Factor in Advanced Hybrid Closed-Loop Insulin Therapy?

Three-dimensional regional bi-ventricular shape remodeling is associated with exercise capacity in endurance athletes

Circuit Breakers in Low- and Medium-Voltage DC Microgrids for Protection against Short-Circuit Electrical Faults: Evolution and Future Challenges

The ALHAMBRA survey: tight dependence of the optical mass-to-light ratio on galaxy colour up to z = 1.5

An innovative DNA extraction method: Water versus commercial buffers

The ALHAMBRA survey: 2D analysis of the stellar populations in massive early-type galaxies at z < 0.3

Evaluation of two FTA card elutions with sterile vs distilled water

Effect of β-glucans on viscoelastic properties of barley kernels and their relationship to structure and soluble dietary fibre

OP04.01: Unique cardiac remodelling in young adults born small for gestational age with subsequent central obesity

Antitumor effect of a novel proapoptotic peptide that impairs the phosphorylation by the protein Kinase 2 (casein Kinase 2)

Inusual complicación en cirugía laparoscópica de urgencia: sección accidental de catéter de derivación ventriculoperitoneal

Preliminary data about the influence of vitamin D status on the loss of body fat in young overweight/obese women following two types of hypocaloric diet

Suchergebnisse filtern