UB Paderborn / Katalog / Suche / in CDI

1 – 25 von 1.078

Sortiert nach

Social jetlag, academic achievement and cognitive performance: Understanding gender/sex differences

Chronobiology international, 2015-07, Vol.32 (6), p.822-831

2015

Volltextzugriff (PDF)

Morningness–eveningness is not associated with academic performance in the afternoon school shift: Preliminary findings

British journal of educational psychology, 2018-09, Vol.88 (3), p.480-498

2018

Volltextzugriff (PDF)

PD-L1 gene polymorphisms and low serum level of PD-L1 protein are associated to type 1 diabetes in Chile

Diabetes/metabolism research and reviews, 2014-11, Vol.30 (8), p.761-766

2014

Volltextzugriff (PDF)

Validation of the MESSi among adult workers and young students: General health and personality correlates

Chronobiology international, 2017-01, Vol.34 (9), p.1288-1299

2017

Volltextzugriff (PDF)

Use of low-molecular-weight heparin in severe paraquat poisoning: a case report

Journal of medical case reports, 2020-12, Vol.14 (1), p.240-6, Article 240

2020

Volltextzugriff (PDF)

The psychometric properties of the Spanish version of the Morningness-Eveningness Stability Scale improved (MESSi) in adolescents

Chronobiology international, 2022-11, Vol.39 (11), p.1411-1418

2022

Volltextzugriff (PDF)

A collaborative system for endovascular treatment of acute ischaemic stroke: the Madrid Stroke Network experience

European journal of neurology, 2016-02, Vol.23 (2), p.297-303

2016

Volltextzugriff (PDF)

Factors Underpinning the Shift to Eveningness during Early Adolescence: Pubertal Development and Family Conflicts

Journal of youth and adolescence, 2023-03, Vol.52 (3), p.561-569

2023

Volltextzugriff (PDF)

Cross-cultural validity of Morningness-Eveningness Stability Scale improved (MESSi) in Iran, Spain and Germany

Chronobiology international, 2017-02, Vol.34 (2), p.273-279

2017

Volltextzugriff (PDF)

Facebook use and chronotype: Results of a cross-sectional study

Chronobiology international, 2015-10, Vol.32 (9), p.1315-1319

2015

Volltextzugriff (PDF)

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

International journal of laboratory hematology, 2017-10, Vol.39 (5), p.539-545

2017

Volltextzugriff (PDF)

Characteristics of hospital emergency departments users. Frequent users

Semergen, medicina de familia, 2018-11, Vol.44 (8), p.537-548

2018

Volltextzugriff (PDF)

A randomized controlled trial to test an HIV-prevention intervention for Latino gay and bisexual men: lessons learned

AIDS care, 2005-04, Vol.17 (3), p.314-328

2005

Volltextzugriff (PDF)

Morningness-eveningness and amplitude - development and validation of an improved composite scale to measure circadian preference and stability (MESSi)

Chronobiology international, 2016, Vol.33 (7), p.832-848

2016

Volltextzugriff (PDF)

Psychometric assessment of the short-form Child Perceptions Questionnaire: an international collaborative study

Community dentistry and oral epidemiology, 2016-12, Vol.44 (6), p.549-556

2016

Volltextzugriff (PDF)

Influence of burnout on the health of prison workers

Revista Española de Sanidad Penitenciaria, 2015-02, Vol.17 (3), p.67-73

2015

Volltextzugriff (PDF)

Obesity as a risk factor for complications during acute respiratory infections in children

Revista medíca de Chile, 2016-09, Vol.144 (9), p.1177-1184

2016

Volltextzugriff (PDF)

Prevalence of multiple sclerosis in Ecuador

Neurología (Barcelona, Spain), 2010-06, Vol.25 (5), p.309-313

2010

Volltextzugriff (PDF)

Diagnosis of Vitality in Skin Wounds in the Ligature Marks Resulting From Suicide Hanging

The American journal of forensic medicine and pathology, 2017-09, Vol.38 (3), p.211-218

2017

Volltextzugriff (PDF)

Immunoglobulin G Avidities in Infants in Mexico after Primary Immunization with Three Doses of Polyribosylribitol Phosphate-Tetanus Toxoid Haemophilus influenzae Type b Vaccine

Clinical and Vaccine Immunology, 2008-06, Vol.15 (6), p.1024-1027

2008

Volltextzugriff (PDF)

Phenotypic characterization of idiosyncratic drug‐induced liver injury: The influence of age and sex

Hepatology (Baltimore, Md.), 2009-06, Vol.49 (6), p.2001-2009

2009

Volltextzugriff (PDF)

Trajectories of symptom dimensions in short-term response to antipsychotic treatment in patients with a first episode of non-affective psychosis

Psychological medicine, 2014-01, Vol.44 (1), p.37-50

2014

Volltextzugriff (PDF)

A multicentre report from the Mexican Retinoblastoma Group

British journal of ophthalmology, 2004-08, Vol.88 (8), p.1074-1077

2004

Volltextzugriff (PDF)

Relationship between paravascular abnormalities and foveoschisis in highly myopic patients

Eye (London), 2015-02, Vol.29 (2), p.280-285

2015

Volltextzugriff (PDF)

Perception and description of violent experience in youth dating relationships

Gaceta sanitaria, 2015-01, Vol.29 (1), p.21

2015

Volltextzugriff (PDF)

1 – 25 von 1.078

Suche als RSS-Feed

Aktive Filter

KollektionOxford University Press Journals Current

KollektionSingle Journals

ThemaAdolescent

ThemaHumans

Suchergebnisse filtern

Filter anzeigen

Nur zeigen

Geprüft (Peer-Review)
(926)
Mit Volltextzugriff
(732)

Publikationsform

Sprache

3 weitere anzeigen...

Weniger anzeigen...

Erscheinungsjahr

n.n

Thema

13 weitere anzeigen...

Weniger anzeigen...

Zeitschrift / Serie

5 weitere anzeigen...

Weniger anzeigen...

Menü

Weitere Dienste

Einstellungen

Social jetlag, academic achievement and cognitive performance: Understanding gender/sex differences

Morningness–eveningness is not associated with academic performance in the afternoon school shift: Preliminary findings

PD-L1 gene polymorphisms and low serum level of PD-L1 protein are associated to type 1 diabetes in Chile

Validation of the MESSi among adult workers and young students: General health and personality correlates

Use of low-molecular-weight heparin in severe paraquat poisoning: a case report

The psychometric properties of the Spanish version of the Morningness-Eveningness Stability Scale improved (MESSi) in adolescents

A collaborative system for endovascular treatment of acute ischaemic stroke: the Madrid Stroke Network experience

Factors Underpinning the Shift to Eveningness during Early Adolescence: Pubertal Development and Family Conflicts

Cross-cultural validity of Morningness-Eveningness Stability Scale improved (MESSi) in Iran, Spain and Germany

Facebook use and chronotype: Results of a cross-sectional study

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

Characteristics of hospital emergency departments users. Frequent users

A randomized controlled trial to test an HIV-prevention intervention for Latino gay and bisexual men: lessons learned

Morningness-eveningness and amplitude - development and validation of an improved composite scale to measure circadian preference and stability (MESSi)

Psychometric assessment of the short-form Child Perceptions Questionnaire: an international collaborative study

Influence of burnout on the health of prison workers

Obesity as a risk factor for complications during acute respiratory infections in children

Prevalence of multiple sclerosis in Ecuador

Diagnosis of Vitality in Skin Wounds in the Ligature Marks Resulting From Suicide Hanging

Immunoglobulin G Avidities in Infants in Mexico after Primary Immunization with Three Doses of Polyribosylribitol Phosphate-Tetanus Toxoid Haemophilus influenzae Type b Vaccine

Phenotypic characterization of idiosyncratic drug‐induced liver injury: The influence of age and sex

Trajectories of symptom dimensions in short-term response to antipsychotic treatment in patients with a first episode of non-affective psychosis

A multicentre report from the Mexican Retinoblastoma Group

Relationship between paravascular abnormalities and foveoschisis in highly myopic patients

Perception and description of violent experience in youth dating relationships

Aktive Filter

Suchergebnisse filtern