Details

Autor(en) / Beteiligte

• Gonçalves, Cristine
• Ardourel, Marie-Yvonne
• Decoville, Martine
• Breuzard, Gilles
• Midoux, Patrick
• Hartmann, Brigitte
• Pichon, Chantal

Titel

An optimized extended DNA kappa B site that enhances plasmid DNA nuclear import and gene expression

Ist Teil von

• The journal of gene medicine, 2009-05, Vol.11 (5), p.401-411

Ort / Verlag

Chichester, UK: John Wiley & Sons, Ltd

Erscheinungsjahr

2009

Link zum Volltext

Quelle

MEDLINE

Beschreibungen/Notizen

• Background The nuclear factor kappa B (NFκB) transcription factor, which shuttles between the cytoplasm and the nucleus under specific conditions, is a suitable intracellular target to increase the nuclear import of plasmid DNA. We report the design of an optimized and extended NFκB DNA binding sequence that promotes an efficient plasmid nuclear import. Methods On the basis of structural studies, the 5′‐CTGGGGACTTTCCAGCTGGGGACTTTCCAGCTGGGGACTTTCCAGG‐3′ segment (termed 3NF) comprising three 10‐bp κB sites (GGGACTTTCC) separated by a 5‐bp optimized spacer (AGCTG) was selected for its capacity to ensure the best structural fit with NFκB and to fix simultaneously three proteins. Plasmids encoding luciferase and bearing this sequence (3NF‐plasmids) were constructed and their nuclear import and gene expression efficiencies compared with that of plasmids containing classical κB motifs. Results A high luciferase expression was associated with plasmids containing one (p3NF‐luc) or two (p3NF‐luc‐3NF) 3NF sequences. In situ hybridization experiments and quantitative measurement of the number of plasmid copies demonstrated that the nuclear delivery of 3NF‐plasmids was more efficient than that of 3NF‐free plasmids. Cross‐linked immunoprecipitation showed that 3NF‐plasmids were recognized by NFκB inside cells upon transfection. The nuclear delivery was inhibited with BAY 11‐7085, an inhibitor of NFκB activation. Finally, p3NF‐luc‐3NF, the most efficient construct for in vitro transfection, had a long‐lived luciferase expression in vivo. Conclusions The results obtained in the present study demonstrate the NFκB‐mediated nuclear delivery of 3NF‐plasmids. Due to its high affinity for fixing several NFκB, the 3NF sequence is a very promising helper for a nonviral gene delivery system. Copyright © 2009 John Wiley & Sons, Ltd.